Bioinformatics at COMAV

Generadores

Supongamos que tenemos un fichero con una lista de genes:

rubisco
ADH
apelatala

Ya sabemos como escribir una función que lea este fichero y devuelva una lista con las palabras:

def leer_palabras(fichero):
    palabras = []
    for linea in open(fichero):
        palabras.append(linea.strip())
    return palabras

for palabra in palabras:
    print palabra #o lo que tengamos que hacer con ella

Esta función crea primero una lista de palabras vacías. A continuación recorre el fichero y añade todas las palabras a la lista y cuando acaba devuelve la lista de palabras.

Este forma de programación es completamente correcta y ampliamente usada, pero Python dispone de una variante de las funciones que puede en muchas ocasiones simplificar este tipo de problemas, el generador. El problema anterior resuelto con generadores sería:

def leer_palabras(fichero):
    for linea in open(fichero):
        yield linea.strip()

for palabra in palabras:
    print palabra #o lo que tengamos que hacer con ella

La primera diferencia que salta a la vista entre la solución con funciones y la solución con generadores es que la segunda tiene la mitad de líneas que la primera, por lo que resulta mucho más sencilla de entender. La diferencia sintáctica entre una función y un generador estriba en que mientras en la función se utiliza return en el generador se utiliza yield. En la función creábamos una lista y guardábamos todas las palabras en ella antes de devolverla. En el generador las palabras se van devolviendo de una en una a medida que se leen. En realidad cada vez que el bucle for requiere una nueva palabra se hace una llamada al generador que devuelve esa palabra. En el caso del generador sólo hay una palabra en la memoria, nunca se encuentra la lista completa. Esta es otra de las ventajas de los generadores, son muy eficientes por lo que respecta a la memoria.

Un generador es en realidad un tipo particular de una clase de objetos más amplia, los iteradores. Existen otras formas de definir iteradores en Python que no vamos a estudiar en esta introducción y Python tiene muchas funciones predefinidas que en realidad son iteradores. Por ejemplo, la función open que hemos utilizado en numerosas ocasiones para abrir ficheros de texto es en realidad un iterador que nos va devolviendo las líneas de una en una. En Python 3.x se hace un uso todavía más común de los iteradores, muchas de las funciones que en Python 2.x devuelven listas, como range, en Python 3.x se han convertido en iteradores.

El comportamiento de los iteradores es en cierto modo similar al de una lista. Cuando utilizamos un bucle for para recorrer todas las líneas de un fichero nos parece que estemos recorriendo la lista de líneas, cuando en realidad las líneas son generadas de una en una. Siempre que no necesitemos tener todos los elementos de la lista en la memoria a la vez podemos hacer uno de los generadores y los iteradores simplificando, en muchas ocasiones, el código del programa y haciendo un uso más eficiente de la memoria.

En cualquier momento podemos transformar un iterador en una lista leyendo todos sus elementos en memoria. Por ejemplo, si tenemos un iterador con secuencias podemos transformarlo en una lista fácilmente:

>>> secuencias = list(secuencias)

Además si combinamos los iteradores con las herramientas de la programación funcional como map, filter y reduce podemos crear programas muy potentes de un modo muy sencillo. Esta forma de programación funcional es un paradigma alternativo a la programación estructurada que hemos visto en este curso y que se ajusta muy bien a una gran cantidad de problemas biológicos.

Convertir iterador en lista

Ejercicios

  1. Escribir un programa que lea un fichero fasta de secuencias:
>seq1 una secuencia
ACGTAGTCTGAGTCGTAGTCTAGTCTGAGCTA
ATGCTAGTCATGTCTATCGAGTCAGTCTGATGCGT
>seq2 otra secuencia
ATGCTAGTCTGAGTCGTATCGTAGTCTATCAT
ATCGTAGTCGATGCTGATGCTATCTGAT
>seq3 la ultima secuencia
ATCGTAGTCGTAGCGTAGTCGTAGTCTATCTGA
AGTACGTATGGCTATCGTATGCTATGCAGT

Pistas:

  • Para separar el nombre y la descripción se puede usar el método de str split(‘ ‘, 1).
  • Una secuencia se puede guardar en un diccionario con las claves: nombre, descripción y secuencia.
  1. Crear una función que elimine las tres primeras bases de una secuencia y aplicarla a las secuencias leídas en el ejercicio anterior.

Soluciones

  1. Escribir un programa que lea un fichero fasta de secuencias:
>seq1 una secuencia
ACGTAGTCTGAGTCGTAGTCTAGTCTGAGCTA
ATGCTAGTCATGTCTATCGAGTCAGTCTGATGCGT
>seq2 otra secuencia
ATGCTAGTCTGAGTCGTATCGTAGTCTATCAT
ATCGTAGTCGATGCTGATGCTATCTGAT
>seq3 la ultima secuencia
ATCGTAGTCGTAGCGTAGTCGTAGTCTATCTGA
AGTACGTATGGCTATCGTATGCTATGCAGT

Pistas:

  • Para separar el nombre y la descripción se puede usar el método de str split(‘ ‘, 1).
  • Una secuencia se puede guardar en un diccionario con las claves: nombre, descripción y secuencia.
#!/usr/bin/env python

def secuencias_en_fasta(fichero):
    'Genera las secuencias de un fichero fasta'

    #inicializamos las variables que contendra
    #la secuencia sumada de varias lineas
    secuencia = ''
    #y el nombre y la descripcion
    nombre = ''
    descripcion = ''

    #recorremos el fichero linea por linea
    for linea in open(fichero):
        linea = linea.strip()   #quita el retorno de carro

        #una linea con nombre de secuencia
        if linea.startswith('>'):
            #si tenemos una secuencia en memoria
            #este es el momento de devolverla,
            #antes de pasar a procesar una nueva
            #secuencia
            if secuencia:
                seq = {'secuencia': secuencia,
                       'nombre': nombre,
                       'descripcion': descripcion}
                yield seq
            #ahora procesamos la linea creando
            #el nuevo nombre y descripcion
            nombre, descripcion = linea.split(' ', 1)
            nombre = nombre[1:] #elimina el '>'
            #la secuencia es '' porque todavia no
            #hemos leido ninguan linea con secuencia
            secuencia = ''

        #si la linea tiene secuencia hemos de anyadirla
        #a la secuencia que estamos leyendo
        else:
            secuencia += linea

    #cuando el bucle for acabe tendremos una secuencia
    #en memoria que no habremos devuelto.
    if secuencia:
        seq = {'secuencia': secuencia,
               'nombre': nombre,
               'descripcion': descripcion}
        yield seq


def read_fastas(fichero):
    'Lee las secuencias fasta de un fichero'

    #podemos leer todas las secuencias con un bucle for
    for seq in secuencias_en_fasta(fichero):
        print 'nombre ->', seq['nombre']
        print 'descripcion ->', seq['descripcion']
        print 'secuencia ->', seq['secuencia']

    #si queremos guardarlas en una lista
    secuencias = list(secuencias_en_fasta(fichero))
    print secuencias

if __name__ == '__main__':
    read_fastas('secuencias.fasta')
  1. Crear una función que elimine las tres primeras bases de una secuencia y aplicarla a las secuencias leídas en el ejercicio anterior.
def quitar_5_prima(secuencia):
    'Elimina tres bases del 5 prima'
    #esto se haria mejor con copy
    seq = {'nombre': secuencia['nombre'],
           'descripcion': secuencia['descripcion']}

    seq['secuencia'] = secuencia['secuencia'][3:]
    return seq

def read_fastas(fichero):
    'Lee las secuencias fasta de un fichero'

    #podemos leer todas las secuencias con un bucle for
    for seq in secuencias_en_fasta(fichero):
        print 'secuencia antes ->', seq['secuencia']
        seq = quitar_5_prima(seq)
        print 'secuencia despu ->', seq['secuencia']

    #tambien se puede hacer con el iterador directamente
    seqs = secuencias_en_fasta(fichero)
    #utilizando map
    secuencias = map(quitar_5_prima, seqs)
    print secuencias

if __name__ == '__main__':
    read_fastas('secuencias.fasta')
| | index